Primer3 Input Help

Source Sequence

The sequence from which to select primers.

Overlap Size Range

The minimum and maximum sizes of overlap between subsequent PCR products.

Targets

If a Target is specified then a legal primer pair must flank this region. A Target might be a simple sequence repeat site (for example a CA repeat) or a single-base-pair polymorphism. The value should be a space-separated list of

start,length

pairs where start is the index of the first base of a Target, and length is its length.

start,length

pairs where start is the index of the first base of the excluded region, and length is its length. This tag is useful for tasks such as excluding regions of low sequence quality or for excluding regions containing repetitive elements such as ALUs or LINEs.

Product Size Range

Minimum and maximum product size.

Flanking Size

Minimum length (in bases) of the sequence flanking the exon. Primer3 will add this length to each side of the exon, and then designs primers around this sequence. This allows eg mutation analysis of the intron/exon boundaries.

Primer Size

Minimum, Optimum, and Maximum lengths (in bases) of a primer oligo. Primer3 will not pick primers shorter than Min or longer than Max, and with default arguments will attempt to pick primers close with size close to Opt. Min cannot be smaller than 1. Max cannot be larger than 36. (This limit is governed by maximum oligo size for which melting-temperature calculations are valid.) Min cannot be greater than Max.

Primer T_m

Minimum, Optimum, and Maximum melting temperatures (Celsius) for a primer oligo. Primer3 will not pick oligos with temperatures smaller than Min or larger than Max, and with default conditions will try to pick primers with melting temperatures close to Opt.

Primer3 uses the oligo melting temperature formula given in Rychlik, Spencer and Rhoads, Nucleic Acids Research, vol 18, num 12, pp 6409-6412 and Breslauer, Frank, Bloeker and Marky, Proc. Natl. Acad. Sci. USA, vol 83, pp 3746-3750. Please refer to the former paper for background discussion.

Maximum T_m Difference

Maximum acceptable (unsigned) difference between the melting temperatures of the left and right primers.

Max Complementarity

The maximum allowable local alignment score when testing a single primer for (local) self-complementarity and the maximum allowable local alignment score when testing for complementarity between left and right primers. Local self-complementarity is taken to predict the tendency of primers to anneal to each other without necessarily causing self-priming in the PCR. The scoring system gives 1.00 for complementary bases, -0.25 for a match of any base (or N) with an N, -1.00 for a mismatch, and -2.00 for a gap. Only single-base-pair gaps are allowed. For example, the alignment

5' ATCGNA 3'
   || | |
3' TA-CGT 5'

is allowed (and yields a score of 1.75), but the alignment

5' ATCCGNA 3'
   ||  | |
3' TA--CGT 5'

is not considered. Scores are non-negative, and a score of 0.00 indicates that there is no reasonable local alignment between two oligos.

Max 3' Complementarity

The maximum allowable 3'-anchored global alignment score when testing a single primer for self-complementarity, and the maximum allowable 3'-anchored global alignment score when testing for complementarity between left and right primers. The 3'-anchored global alignment score is taken to predict the likelihood of PCR-priming primer-dimers, for example

5' ATGCCCTAGCTTCCGGATG 3'
             ||| |||||
          3' AAGTCCTACATTTAGCCTAGT 5'

or

5` AGGCTATGGGCCTCGCGA 3'
               ||||||
            3' AGCGCTCCGGGTATCGGA 5'

The scoring system is as for the Max Complementarity argument. In the examples above the scores are 7.00 and 6.00 respectively. Scores are non-negative, and a score of 0.00 indicates that there is no reasonable 3'-anchored global alignment between two oligos. In order to estimate 3'-anchored global alignments for candidate primers and primer pairs, Primer assumes that the sequence from which to choose primers is presented 5'->3'. It is nonsensical to provide a larger value for this parameter than for the Maximum (local) Complementarity parameter because the score of a local alignment will always be at least as great as the score of a global alignment.

Max Poly-X

The maximum allowable length of a mononucleotide repeat, for example AAAAAA.

Primer GC%

Minimum, Optimum, and Maximum percentage of Gs and Cs in any primer.

CG Clamp

Require the specified number of consecutive Gs and Cs at the 3' end of both the left and right primer.